Спортивная Генетика
Дисбактериоз
Восстановление после применения антибиотиков
Лямблиоз
Исследование мочи
Спортивная Генетика
Лабораторная диагностика
Научно-популярная микробиология

История геномики

В этой статье я постараюсь популярно рассказать о том, как появились первые методы чтения генетических последовательностей, в чем они заключались и как геномика двигалась от чтения отдельных генов к чтению полных геномов, в том числе полных геномов конкретных людей. 

Часть первая.
      

        Вскоре после открытия Уотсона и Крика рождается геномика – наука об исследовании геномов организмов, которая включает интенсивное чтение полных последовательностей ДНК (секвенирование) и нанесение их на генетические карты. Это наука также рассматривает взаимодействия между генами и аллелями генов и их разнообразие, закономерности в эволюции и устройства геномов. Развитие этой области происходило так стремительно, что еще совсем недавно текстовые редакторы вроде Microsoft Word не знали слова «геном» и пытались исправить его на слово «гном».

Джеймс Уотсон (слева) и Френсис Крик (справа) – ученые, открывшие двойную спираль ДНК

     Самым первым был прочтен ген белка оболочки РНК-вируса, бактериофага MS2, изученный в лаборатории Валтера Файерса в 1972 г. В 1976 г. была расшифрована первичная и вторичная структура гена его репликазы – фермента, отвечающего за размножение вирусных частиц. Короткие молекулы РНК тогда уже читались сравнительно легко, но крупные молекулы ДНК читать толком еще не умели. К примеру, полученная в 1973 г. Вальтером Гилбертом и Алленом Максамом [4] последовательность участка гена лактозного оперона, длиной в 24 нуклеотида, рассматривалась как существенный прорыв в науке. Вот эта последовательность:

         5'—TGGAATTGTGAGCGGATAACAATT 3'
         3'—ACCTTAACACTCGCCTATTGTTAA 5'

     Первые техники чтения ДНК были очень неэффективными и использовали радиоактивные метки для ДНК и химические методы различения нуклеотидов. Например, можно было взять ферменты, которые разрезают нуклеотидную последовательность с разной вероятностью после разных «букв». Молекула ДНК состоит из 4-х букв-нуклеотидов A, T, G и С (аденин, тимин, гуанин и цитозин), которые входят в состав двойной антипараллельной (две цепи направлены в противоположные стороны) спирали. Внутри этой спирали нуклеотиды находятся друг напротив друга в соответствии с правилом комплементарности: напротив А в другой цепи стоит T, напротив G – С и наоборот.

     Гилберт и Максам использовали 4 типа ферментов. Один разрезал после А или G, но лучше после A (A>G), второй разрезал лучше после G (G>A), третий после C, а четвертый после С или T (С+T). Реакция проводилась в 4 пробирках с каждым типом ферментов, а затем продукты помещали на гель. ДНК – заряженная молекула, и при включении тока бежит от минуса к плюсу. Маленькие молекулы бегут быстрее, поэтому разрезанные молекулы ДНК выстраиваются по длине. Глядя на 4 дорожки геля, можно сказать, в какой последовательности расположены нуклеотиды.

     Прорыв в области секвенирования ДНК случился, когда английский биохимик Фредерик Сенгер в 1975 г. предложил так называемый метод терминации цепи для чтения последовательностей ДНК. Но прежде чем рассказать об этом методе, необходимо разобраться в процессах, происходящих при синтезе новых молекул ДНК. Для синтеза ДНК необходим фермент – ДНК-зависимая ДНК-полимераза, которая способна достраивать одноцепочечную молекулу ДНК до двухцепочечной. Для этого ферменту необходима «затравка» – праймер, короткая последовательность ДНК, способная связаться с длинной одноцепочечной молекулой, которую мы хотим достроить до двухцепочечной. Также необходимы сами нуклеотиды в форме нуклеотидтрифосфатов и некоторые условия, такие как определенное содержание ионов магния в среде и определенная температура. Синтез всегда идет в одном направлении, от конца, называемого 5’, к концу, называемому 3’. Разумеется, для чтения ДНК необходимо большое количество матрицы – то есть копий той ДНК, которую собираются читать.

     В 1975 г. Сенгер придумал следующее. Он брал специальные (терминирующие) нуклеотиды, которые, присоединившись к растущей цепи молекулы ДНК, мешали присоединению последующих нуклеотидов, то есть «обрывали» цепь. Далее он брал 4 пробирки, в каждую из которых добавлял все 4 типа нуклеотидов и один тип терминирующих нуклеотидов в небольшом количестве [6]. Таким образом, в пробирке, где находился терминирующий нуклеотид аденин, синтез каждой новой молекулы ДНК мог оборваться в любом месте, где должна была встать «А», в пробирке с терминирующим гуанином – в любом месте, где должна встать «G» и так далее. На гель наносились 4 дорожки из 4-х пробирок и снова самые короткие молекулы «убегали» вперед, а самые длинные оставались в начале, а по отличиям в полосах можно было сказать, какой нуклеотид следует за каким. Чтобы увидеть полосы, один из четырех нуклеотидов (A, T, G или C) метился, без изменения химических свойств, с использованием радиоактивных изотопов.

Метод Сенгера в классическом варианте – на геле. Показаны три серии из 4-х дорожек.

     С помощью этого метода был прочитан первый геном, основанный на ДНК – геном бактериофага ?X174, длиной 5386 нуклеотидов (геном фага MS2 длиной 3569 нуклеотидов, прочитанный ранее, состоит из РНК). Метод Сенгера был существенно улучшен в лаборатории Лероя Худа, где в 1985 г. радиоактивную метку смогли заменить светящейся, флуоресцентной меткой. Это дало возможность создать первый автоматический секвенатор: каждый отрезок ДНК теперь был окрашен разными цветами в зависимости от того, какой была последняя буква (меченый цветом нуклеотид, обрывающий цепь). Фрагменты разделялись на геле по размерам, и машина автоматически считывала спектр свечения поступающих полос, выдавая результаты на компьютер. В результате такой процедуры получается хроматограмма, по которой легко установить последовательность ДНК длиной до 1000 «букв» с очень небольшим количеством ошибок.

Пример хроматограммы на современном секвенаторе, использующем метод обрывания цепи по Сенгеру и светящуюся метку.

     На многие годы улучшенный метод Сенгера станет основным методом массового секвенирования геномов и будет использован для многих проектов полных геномов, а Сенгер в 1980 г. получит вторую Нобелевскую премию по химии (первую он получил еще в 1958 г. за прочтение аминокислотной последовательности инсулина – первого секвенированного белка). Первым полным геномом клеточного организма стал геном бактерии, вызывающей некоторые формы пневмонии и менингита – Haemophilus influenzae в 1995 г. Геном этой бактерии имел длину 1830137 нуклеотидов. В 1998 г. появляется первый геном многоклеточного животного, круглого червя Caenorhabditis elegans, с 98 миллионами нуклеотидов, а затем в 2000 г. появляется первый растительный геном – Arabidopsis thaliana. Геном этого растения, родственника хрена и горчицы, имеет длину 157 миллионов нуклеотидов. Скорость и масштабы секвенирования росли с изумительной скоростью, и появляющиеся базы данных нуклеотидных последовательностей пополнялись все быстрее и быстрее.

    Наконец, настал черед генома млекопитающих: мыши и человека. Когда в 1990 г. Джеймс Уотсон возглавил проект чтения полного генома человека в Национальных Институтах Здоровья (NIH) в США, многие ученые скептически относились к этой идее. Подобный проект требовал колоссальных вложений денег и времени и, учитывая ограниченные возможности существовавших машин для чтения геномов, многим казался просто невыполнимым. С другой стороны, проект обещал революционные изменения в медицине и понимании устройства человеческого организма, но и здесь были свои проблемы. Дело в том, что в тот момент не существовало какой-либо точной оценки количества генов у человека. Многие полагали, что сложность устройства человеческого организма указывает на наличие у него сотен тысяч генов, а может и несколько миллионов, а, следовательно, разобраться в таком количестве генов, даже если их последовательности удастся прочитать, будет непосильной задачей. Именно в наличии большого количества генов многие предполагали принципиальное отличие человека от других животных – представление, впоследствии опровергнутое проектом «Геном человека».

    Сама идея прочитать геном человека родилась в 1986 г. по инициативе Департамента Энергии США, который впоследствии финансировал проект вместе с NIH. Стоимость проекта была оценена в 3 миллиарда долларов, а сам проект был рассчитан на 15 лет при участии в проекте целого ряда стран: Китай, Германия, Франция, Великобритания и Япония. Для чтения генома человека использовались так называемые «искусственные бактериальные хромосомы» (BAC – bacterial artificial chromosome). При этом подходе геном разрезается на множество частей длиной примерно в 150 тысяч нуклеотидов. Эти фрагменты встраивают в искусственные кольцевые хромосомы, которые встраиваются в бактерии. С помощью бактерий эти хромосомы размножаются, и ученые получают множество копий одного и того же фрагмента молекулы ДНК. Каждый такой фрагмент затем читается отдельно, а прочитанные куски по 150000 нуклеотидов наносятся на карту хромосомы. Данный метод позволяет довольно точно секвенировать геном, однако требует очень больших затрат времени.

    Но проект «Геном человека» двигался крайне медленными темпами. Ученый Крейг Вентер и его компания Celera Genomics, основанная в 1998 г., сыграли примерно такую же роль в истории геномики, как Советский Союз повлиял на полет американцев на луну. Вентер заявил, что его компания закончит секвенирование генома человека раньше, чем завершится государственный проект. На проект потребуется всего 300 миллионов долларов – лишь малая часть от затрат государственного проекта, за счет использования новой технологии секвенирования «whole genome shotgun» – чтения случайных коротких фрагментов генома. Когда Френсис Коллинз, сменивший в 1993 г. Джеймса Уотсона на посту руководителя проекта по чтению генома человека, узнал о намерениях Вентера, он был шокирован. «Мы сделаем геном человека, а вы можете сделать мышку» – предложил Вентер. Научное сообщество всполошилось, и на то был ряд причин. Во-первых, Вентер обещал закончить свой проект в 2001 г., на 4 года раньше срока, намеченного для государственного проекта. Во-вторых, компания Celera Genomics собиралась заработать на проекте, создав базу данных, которая была бы платной для коммерческих фармацевтических компаний.

    В 2000 г. Селера Геномикс доказала эффективность своего метода секвенирования, опубликовав геном плодовой мушки дрозофилы вместе с лабораторией генетика Джеральда Рубина (ранее whole genome shotgun использовался для прочтения первого генома бактерии, но мало кто верил, что этот метод пригоден для крупных геномов). Именно такой пинок со стороны коммерческой компании стимулировал разработку улучшенных и применение более современных методов чтения геномов в проекте «Геном человека». В 2001 г. был опубликован предварительный вариант генома со стороны государственного проекта и Селеры. Тогда была сделана предварительная оценка количества генов в геноме человека, 30-40 тысяч. В 2004 г., почти на два года раньше, чем следовало по плану, вышла окончательная версия генома. В последней статье было сказано, что количество генов у человека предположительно составляет лишь 20-25 тысяч. Это число сравнимо с другими животными, в частности с нематодой C.elegans.

    Практически никто не предполагал, что количество генов, обеспечивающих работу нашего организма, может быть столь мало. Позже стали известны и другие подробности: геном человека имеет длину около трех миллиардов нуклеотидов, бОльшую часть генома составляют некодирующие последовательности, в том числе всевозможные повторы. Лишь небольшая часть генома действительно содержит гены – участки ДНК, с которых считываются функциональные молекулы РНК. Интересный факт, что по мере увеличения знаний о геноме человека число предполагаемых генов только сокращалось: многие потенциальные гены оказывались псевдогенами (неработающими генами), в других случаях несколько генов оказывались частью одного и того же гена.

    Дальнейшие темпы секвенирования возрастали экспоненциально. В 2005 г. опубликован геном шимпанзе, который подтвердил потрясающее сходство между обезьянами и человеком, которое видели еще зоологи прошлого. К 2008 г. были полностью прочитаны геномы 32 позвоночных, включая кошку, собаку, лошадь, макаку, орангутана и слона, 3 генома беспозвоночных вторичноротых, 15 геномов насекомых, 7 геномов червей и сотни геномов бактерий.

    Наконец в 2007 г. человечество приблизилась к возможности секвенирования геномов индивидуальных людей. Первым человеком, для которого прочитали полный индивидуальный геном, стал Крейг Вентер. При этом геном был прочитан так, что можно было сравнить хромосомы Вентера, доставшиеся ему от обоих родителей. Так было выяснено, что между одним и другим набором хромосом внутри одного человека существует около трех миллионов однобуквенных нуклеотидных отличий, не считая огромного количества крупных варьирующих участков. Год спустя опубликован полный диплоидный геном Джеймса Уотсона. Геном Уотсона содержал 3,3 миллиона однобуквенных замен по сравнению с аннотированным геномом человека, из которых более 10000 вели к изменениям в белках, которые кодируют его гены. Геном Уотсона обошелся в 1 миллион долларов, то есть цена на чтение геномов упала более чем в 3000 раз за 10 лет, но и это не предел. Сегодня перед учеными стоит задача «1 геном – $1000 – 1 день», и она уже не кажется невыполнимой с появлением новых технологий секвенирования. О них расскажет следующая часть «истории».

Часть вторая

     В первой части статьи рассказано, как появились первые методы чтения генетических последовательностей, в чем они заключались и как геномика двигалась от чтения отдельных генов к чтению полных геномов, в том числе полных геномов конкретных людей.

     Прежде чем рассказать историю появления новых методов секвенирования хочется рассказать о нескольких необычайных технологиях, связанных с ДНК, которые появились совсем недавно в пике развития геномики. На рис. 1 показаны изображения, полученные путем самосборки ДНК. Таких картинок в пробирке может быть миллионы, и они образуются сами при правильном подборе условий. Эти работы появились в 2006 г. и получили название «ДНК-оригами», в более общем виде – «ДНК-нанотехнологии».

Рис. 1. Снимки упорядоченных структур, составленных из молекул ДНК, под электронным микроскопом

     Но для развития геномики ключевую роль играет другой тип технологий – технологии секвенирования (чтения) геномов. Мы уже разобрали метод Гилберта-Максама 1973 г., следующий за ним метод терминации цепи Сенгера 1975 г. и улучшенный Худом метод Сенгера 1985 г., который позволил создать первые автоматические секвенаторы. Как показала история проекта «Геном человека», эти методы по-прежнему были очень дорогостоящие и медленные – секвенирование первого генома человека стоило более 3 миллиардов долларов и заняло 13 лет. В начале XXI века был достигнут предел секвенаторов, терминирующих цепь: в одном капилляре можно по цене $1 прочитать 1000 нуклеотидов за 1 час, в одной машине – до 100 капилляров. Цена в 1 доллар на самом деле минимальная – в России те же 1000 «букв» читают за $15-20.

     Сегодня появляются все новые и более совершенные методы секвенирования, которые можно разбить на две группы. Старые методы основаны на всевозможных изощренных способах получения большого количества одинаковых молекул ДНК на определенном носителе, для усиления сигнала при чтении молекулы ДНК. Самые поздние методы основаны на разработке сверхточных приборов, способных анализировать одиночные молекулы.

     Прежде чем рассказывать о первом типе приборов, необходимо разобрать так называемую полимеразную цепную реакцию (ПЦР), которая позволяет размножить одну-единственную молекулу ДНК до миллиона или даже миллиарда копий. Технология была разработана в 1984-1986 годах Кэри Муллис. При высокой температуре (порядка 95 градусов) молекула ДНК денатурирует: превращается из двухцепочечной молекулы в две одноцепочечные. При более низкой температуре (обычно это 40-60 градусов) к одноцепочечной молекуле ДНК может присоединится короткий фрагмент – праймер, который по своей последовательности комплементарен приблизительно 20 нуклеотидам длинной молекулы ДНК. При температуре около 72 градусов специальный фермент – ДНК-полимераза, выделенная из бактерий, живущих в горячих источниках, может достроить одноцепочечную молекулу ДНК, к которой присоединился праймер, до двухцепочечной. Если мы знаем последовательность 20 нуклеотидов в левой части крупной молекулы ДНК и в правой ее части, то мы можем, используя два праймера (слева и справа), с экспоненциально возрастающей скоростью размножить фрагмент ДНК. Для этого надо циклически нагревать смесь реагентов до 95 градусов (денатурация), охлаждать до 60 (отжиг праймеров), нагревать до 72 (достраивание цепи) и снова денатурировать (температура указана приблизительно и зависит от конкретных праймеров и полимеразы). Схематично это изображено на рис. 2. Удивительно, но для успешной реакции ПЦР теоретически достаточно иметь одну-единственную молекулу «матрицы», то есть можно взять ДНК из одной клетки и размножить любой фрагмент ее ДНК в любое количество раз.

Рис. 2. Три цикла полимеразной цепной реакции. Темно-красным и темно-зеленым показаны праймеры.

Полимеразная цепная реакция (ПЦР):

Рис. 3. Технология 454. Используются шарики размером 44нм, на которых размножаются молекулы ДНК.

     В том же 2005 г.  лабораторией Джорджа Черча был предложен другой метод с использованием точно таких же шариков, только меньшего размера. Такие шарики, размером с микрон и хранящие на себе множество идентичных копий молекулы ДНК прилепляют к специальному стеклышку. Далее добавляют смесь праймеров вида XNNNNNNNN, где N – любой нуклеотид, а X – известный нуклеотид, к которому прикреплена молекула красителя определенного цвета (4 цвета на каждую «букву»). Не вдаваясь в детали, скажем лишь, что по тому, какого цвета праймеры прилипают к каждому шарику, мы узнаем, какой нуклеотид находится на этом шарике. Праймеры вида XNNNNNNNN указывают первую «букву», NXNNNNNNN – вторую и так далее. Цена примерно в 9 раз меньше, чем цена секвенирования по Сенгеру.

     Третий оригинальный метод чтения ДНК предложен компанией Illumina в 2005 г.  и реализован в виде платформы Solexa на пути к плану «$1000 долларов – один геном». Молекула ДНК разрезается, и к ней пришиваются с обеих сторон два разных адаптера. На специальное стеклышко приклеиваются точно такие же адаптеры, которые служат праймерами. Молекул ДНК берется мало, и они прилипают в случайном месте стеклышка, после чего добавляют ферменты, необходимые для ПЦР. Поскольку все праймеры прилеплены к стеклышку, то новые копии молекулы ДНК будут образовываться рядом.

     Так вокруг каждой исходной молекулы ДНК вырастает целый «лес» (рис. 4) одинаковых молекул, и таких кластеров образуются миллионы. Далее добавляют свободно плавающие праймеры и меченые флуоресцентными красителями разных цветов терминирующие нуклеотиды всех четырех типов – так к каждой молекуле ДНК присоединится праймер и только 1 нуклеотид, цвет которого можно определить с помощью лазера. Затем нуклеотид химически модифицируют, чтобы к нему мог прилипнуть следующий терминирующий нуклеотид, и так далее.


Рис. 4. Illumina Solexa — кластеры ДНК.

     Но уже через несколько лет после появления этих секвенаторов многое успело измениться. Современные детекторы способны регистрировать сигналы, полученные от отдельных молекул, что сняло задачу усиления сигнала путем амплификации ДНК (как это делали, используя Solexa или 454). Начиная с 2008 г. на вопрос «как читают последовательность молекулы ДНК?» можно ответить: «берем молекулу и читаем». Компания Helicos разработала секвенатор нового поколения. По новому методу ДНК режется на части, и к одному из концов фрагмента прикрепляют длинную последовательность из молекул аденина («букв А») с помощью специального фермента, а в конце ставят светящуюся метку. На специальном стеклышке приклеены молекулы ДНК, состоящие из множества «букв T». Когда образец выливают на стеклышко, то молекулы ДНК прилипают участками, содержащими нуклеотиды «А», к прикрепленным к стеклышку нуклеотидам «T» по принципу комплементарности. Далее специальный микроскоп сканирует стеклышко и по свечению метки находит положение каждого прилипшего отрезка молекулы ДНК (рис. 5). Метку отмывают и добавляют по очереди каждый из четырех типов нуклеотидов с меткой. Снова смотрят свечение молекул, снова отмывают метку и присоединяют следующий нуклеотид. Специальный компьютер записывает положение миллионов вспышек после каждой реакции. Такая система позволяет читать миллиарды нуклеотидов в день.

Рис. 5. Технология Helicos. Каждая светящаяся точка – отдельный нуклеотид! 


Секвенирование с помощью Helicos.

      Но и это, оказалось, не предел. В 2009 г.  появляется революционно новый метод чтения ДНК с использованием того же инструмента, который использует клетка при делении – ДНК-полимеразы, фермента, который удваивает ДНК. Прибор, разработанный в лаборатории Стивена Тернера, действительно уникален. На дно специальных ячеек, расположенных на прозрачном стекле, прикрепляются одиночные молекулы ДНК-полимеразы (рис. 6). Область ничтожного размера прямо вокруг закрепленного фермента просвечивается с помощью специального лазера. В ячейку добавляют нуклеотиды всех четырех типов, помеченные разными светящимися маркерами. Область, которую анализирует лазер, столь мала, что молекула в норме не задерживается в ней долго, уплывает и не оставляет сигнала. Если же во время удвоения ДНК молекула удерживается полимеразой, то молекула задерживается в сканируемой области и оставляет сигнал. После присоединения нуклеотида светящаяся метка отваливается и уплывает. Таким образом, скорость чтения у такого прибора становится равной скорости работы полимеразы.

Рис. 6. Технология SMART Pacific Biosciences – чтение одиночных молекул во время их происоединения к нарастающей цепи ДНК с помощью ДНК-полимеразы.

     Видео Pacific Biosciences можно посмотреть на сайте компании.

     Таким образом, за последние 10 лет произошел переворот в возможности чтения геномов. Цена секвенирования тысячи нуклеотидов упала с менее $1 по методу Сенгера в 1990-х до 5 центов с технологией 454 в 2005, затем в том же году до 0,2 цента с технологией Illumina и, наконец, 0.05 цента – с технологией Helicos. Цена чтения ДНК с самыми последними секвенаторами компаний Complete Genomics и Pacific Biosciences, которые, вероятно появятся на рынке в этом и следующем году, еще неизвестна, но прогнозы весьма оптимистичны.

     Возникает вопрос: а что дала и сможет дать людям геномика? Ответ прост: очень много.

     Прочитанные геномы дают основу для построения эволюционных деревьев, что поможет разобраться в том, как именно шла эволюция живых организмов на нашей планете. Когда стоимость чтения геномов животных приблизится к порогу $1000 за геном, станет возможным прочитать геномы всех живых организмов, исследовать любые родственные взаимоотношения между любыми группами живых организмов и разработать новую систематику.

     Во-вторых, мы узнаём все больше и больше о роли наших генов. Благодаря сравнению генома человека и человекообразных обезьян мы узнали, что не количество генов делает нас отличными от остальных животных, а их качество, особенности. Сравнивая геномы разных животных, мы можем узнать, за что отвечает каждый из генов, а может быть – даже улучшить тот или иной ген, чтобы вывести новый, более приспособленный организм. Генетические данные активно используются при создании медицинских препаратов или новых сельскохозяйственных культур.  
     Последние исследования по изучению одиночных мутаций в генах показывают связь между определенными генетическими вариациями и различными заболеваниями и особенности тела и психики человека. Так существуют гены, определяющие то, станем ли мы лысеть, какой у нас цвет глаз, рост, насколько нам грозит диабет или определенная форма рака, есть ли у нас предрасположенность к спорту, полезно ли для нас принятие кофе, алкоголя или аспирина. С 2007 года стали появляться компании, такие как 23AndMe (их генетическая диагностика за $399 – лучшее изобретение 2008 года по регтингу журнала Time), Navigenics или DecodeMe, которые используют так называемые ДНК-чипы для определения генетических характеристик подобного рода. Возможность читать целые геномы многократно улучшит предсказательные способности таких проектов, надежность, детализированность и точность предсказаний, адекватность рекомендаций (рис. 7).

Рис. 7. Наши знания о человеке в «догеномную эру»

 

Рис. 8. Наши знания о человеке в начале эпохи геномики

     Сегодня мы еще не умеем изменять гены взрослых людей, но можем предотвратить многие генетические заболевания, если будем знать причину и заблаговременно начнем профилактику или лечение. Так, исследования гена, связанного с прогрессирующей формой миопатии, процессов при его прочтении в клетке, позволили разработать лекарства, спасающие тех, кто в противном случае был бы обречен. Изучение функций генов открывает дорогу персональной фармакогеномике – индивидуальному подходу к лечению. Людей с разными генами следует лечить по-разному: кому-то поможет одно лекарство, кому-то другое, и это важно знать.

     Безусловно, такие возможности породят новые социальные, этические и философские проблемы. Медицинские страховые компании могут захотеть информацию о геноме клиентов, чтобы решить, выгодно ли им дать страховку – сделать им скидку для человека, который генетически обещает быть здоровым или заставить потенциального больного платить за страховку больше? Правильно ли это? Не следует ли спортсменам соревноваться в разных категориях по аллеям генов, связанных с физической подготовкой, так же как боксеры легкого веса не дерутся с тяжеловесами? Можно ли использовать генетическую информацию, чтобы отдать предпочтение тому или иному сотруднику компании в повышении или устройстве на работу? В США подобная дискриминация уже запрещена, однако армия США проводит свои генетические анализы. Уже сегодня знания о возможных опасных для здоровья генах помогают выбирать самых здоровых зародышей при экстракорпоральном оплодотворении, но можно ли менять гены будущих людей в зиготе (сперматозоиде или яйцеклетке) или в оплодотворенной яйцеклетке?

     В любом случае, как показывает история последних десятилетий, развитие этих технологий неизбежно, как неизбежно то, что когда-нибудь они станут доступны (если не обязательны) для всех. Нам же остается готовиться к грядущим переменам и участвовать в них.

 





© 2009-2015 OOO «Лабораторные технологии»
Телефон/факс : +7 (342)291-21-91, 205-52-90
E-mail: labt1@yandex.ru